circad | circRNAs associated with diseases

hsa_circ_0000831
Gene	CEP192	Organism	Human
Genome Locus	n/a	Build	hg19
Disease	Gliomas	ICD-10	Malignant neoplasm of Brain, unspecified (C71.9)
DBLink	Link to database	PMID	26873924
Experimental Method
Sample Type	Tissues	Comparison	19 fresh-frozen de novo Glioblastoma Multiforme (GBM) and 7 oligodendroglioma
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward CTCTGGTACTTGGGGAACTGAG Reverse GCAACAGGCAAGCCAAGATTT	Statistics	Fold Change : Downregulated pvalue : p<0.05
Citation
Song, X, Zhang, N, Han, P, Moon, BS, Lai, RK, Wang, K, Lu, W (2016). Circular RNA profile in gliomas revealed by identification tool UROBORUS. Nucleic Acids Res., 44, 9:e87.